51![Genome Informatics 16(2): 247–Prediction of Functional Modules Based on Gene Distributions in Microbial Genomes Genome Informatics 16(2): 247–Prediction of Functional Modules Based on Gene Distributions in Microbial Genomes](https://www.pdfsearch.io/img/a00d882fe69601aae55334999f7f1a9e.jpg) | Add to Reading ListSource URL: www.jsbi.orgLanguage: English - Date: 2005-12-28 06:18:56
|
---|
52![EMBARGOED UNTILUK TIMEUS EASTERN TIME What Sex did to the X – and Why A chromosome account of evolution and revolution The human X chromosome is about sex and how it evolved. It also has a unique positio EMBARGOED UNTILUK TIMEUS EASTERN TIME What Sex did to the X – and Why A chromosome account of evolution and revolution The human X chromosome is about sex and how it evolved. It also has a unique positio](https://www.pdfsearch.io/img/d94f385c844c5990e5e9f6f83aa07ac5.jpg) | Add to Reading ListSource URL: genome.imb-jena.deLanguage: English - Date: 2005-03-16 10:35:42
|
---|
53![Genome Informatics 16(2): 69–Strategies for Genome Reduction in Microbial Genomes Kishore R. Sakharkar Genome Informatics 16(2): 69–Strategies for Genome Reduction in Microbial Genomes Kishore R. Sakharkar](https://www.pdfsearch.io/img/4f3a6dcd5f9cb2754f444ca5ac9fd04c.jpg) | Add to Reading ListSource URL: www.jsbi.orgLanguage: English - Date: 2005-12-28 06:18:58
|
---|
54![Genome Informatics 15(1): 229–Causes for the Large Genome Size in a Cyanobacterium Anabaena sp. PCC7120 Genome Informatics 15(1): 229–Causes for the Large Genome Size in a Cyanobacterium Anabaena sp. PCC7120](https://www.pdfsearch.io/img/020aa376dd83a67c65e49c2d210deb71.jpg) | Add to Reading ListSource URL: www.jsbi.orgLanguage: English - Date: 2004-05-17 21:39:16
|
---|
55![de la Chaux and Wagner BMC Evolutionary Biology 2011, 11:154 http://www.biomedcentral.com RESEARCH ARTICLE Open Access de la Chaux and Wagner BMC Evolutionary Biology 2011, 11:154 http://www.biomedcentral.com RESEARCH ARTICLE Open Access](https://www.pdfsearch.io/img/ff1411d31f48673c47280ed3a45e38c7.jpg) | Add to Reading ListSource URL: www.ieu.uzh.chLanguage: English - Date: 2015-12-07 07:40:29
|
---|
56![Evolution von Plastidengenomen Lehrprobe 18. Oktober 2006 vor der Habilitationskommission der Fakultät für Biologie und Pharmazie Friedrich-Schiller-Universität Jena Gernot Glöckner Evolution von Plastidengenomen Lehrprobe 18. Oktober 2006 vor der Habilitationskommission der Fakultät für Biologie und Pharmazie Friedrich-Schiller-Universität Jena Gernot Glöckner](https://www.pdfsearch.io/img/bfc50458c890a73fdf8488efe68efc86.jpg) | Add to Reading ListSource URL: genome.imb-jena.deLanguage: German - Date: 2006-10-23 08:42:22
|
---|
57![Scientific Report First name / Family name Nationality Name of the Host Organisation First Name / family name Scientific Report First name / Family name Nationality Name of the Host Organisation First Name / family name](https://www.pdfsearch.io/img/0cc9ce40bd8de3e86a027765162b6e9d.jpg) | Add to Reading ListSource URL: fellowship.ercim.euLanguage: English - Date: 2013-02-11 08:41:46
|
---|
58![GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA](https://www.pdfsearch.io/img/4d7f36685ef93ca9ba8d30394145153d.jpg) | Add to Reading ListSource URL: bejerano.stanford.eduLanguage: English - Date: 2009-04-17 16:28:41
|
---|
59![Genome Informatics 16(1): 13–Relationship between Segmental Duplications and Repeat Sequences in Human Chromosome 7 Genome Informatics 16(1): 13–Relationship between Segmental Duplications and Repeat Sequences in Human Chromosome 7](https://www.pdfsearch.io/img/dc601e913d57e2e8d22253638b41c388.jpg) | Add to Reading ListSource URL: www.jsbi.orgLanguage: English - Date: 2005-12-28 10:55:26
|
---|
60![Genome Indices database 1 Integration of Biological Features of Multiple Genomes - The Construction of “Genome Indices” database Shujiro Okuda Genome Indices database 1 Integration of Biological Features of Multiple Genomes - The Construction of “Genome Indices” database Shujiro Okuda](https://www.pdfsearch.io/img/33232e932af86c9a384300dd1238c97f.jpg) | Add to Reading ListSource URL: www.jsbi.orgLanguage: English - Date: 2004-06-07 22:06:09
|
---|