Genome evolution

Results: 534



#Item
51Genome Informatics 16(2): 247–Prediction of Functional Modules Based on Gene Distributions in Microbial Genomes

Genome Informatics 16(2): 247–Prediction of Functional Modules Based on Gene Distributions in Microbial Genomes

Add to Reading List

Source URL: www.jsbi.org

Language: English - Date: 2005-12-28 06:18:56
52EMBARGOED UNTILUK TIMEUS EASTERN TIME  What Sex did to the X – and Why A chromosome account of evolution and revolution The human X chromosome is about sex and how it evolved. It also has a unique positio

EMBARGOED UNTILUK TIMEUS EASTERN TIME What Sex did to the X – and Why A chromosome account of evolution and revolution The human X chromosome is about sex and how it evolved. It also has a unique positio

Add to Reading List

Source URL: genome.imb-jena.de

Language: English - Date: 2005-03-16 10:35:42
    53Genome Informatics 16(2): 69–Strategies for Genome Reduction in Microbial Genomes Kishore R. Sakharkar

    Genome Informatics 16(2): 69–Strategies for Genome Reduction in Microbial Genomes Kishore R. Sakharkar

    Add to Reading List

    Source URL: www.jsbi.org

    Language: English - Date: 2005-12-28 06:18:58
    54Genome Informatics 15(1): 229–Causes for the Large Genome Size in a Cyanobacterium Anabaena sp. PCC7120

    Genome Informatics 15(1): 229–Causes for the Large Genome Size in a Cyanobacterium Anabaena sp. PCC7120

    Add to Reading List

    Source URL: www.jsbi.org

    Language: English - Date: 2004-05-17 21:39:16
    55de la Chaux and Wagner BMC Evolutionary Biology 2011, 11:154 http://www.biomedcentral.com RESEARCH ARTICLE  Open Access

    de la Chaux and Wagner BMC Evolutionary Biology 2011, 11:154 http://www.biomedcentral.com RESEARCH ARTICLE Open Access

    Add to Reading List

    Source URL: www.ieu.uzh.ch

    Language: English - Date: 2015-12-07 07:40:29
    56Evolution von Plastidengenomen  Lehrprobe 18. Oktober 2006 vor der Habilitationskommission der Fakultät für Biologie und Pharmazie Friedrich-Schiller-Universität Jena Gernot Glöckner

    Evolution von Plastidengenomen Lehrprobe 18. Oktober 2006 vor der Habilitationskommission der Fakultät für Biologie und Pharmazie Friedrich-Schiller-Universität Jena Gernot Glöckner

    Add to Reading List

    Source URL: genome.imb-jena.de

    Language: German - Date: 2006-10-23 08:42:22
      57Scientific Report  First name / Family name Nationality Name of the Host Organisation First Name / family name

      Scientific Report First name / Family name Nationality Name of the Host Organisation First Name / family name

      Add to Reading List

      Source URL: fellowship.ercim.eu

      Language: English - Date: 2013-02-11 08:41:46
      58GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA

      GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA

      Add to Reading List

      Source URL: bejerano.stanford.edu

      Language: English - Date: 2009-04-17 16:28:41
      59Genome Informatics 16(1): 13–Relationship between Segmental Duplications and Repeat Sequences in Human Chromosome 7

      Genome Informatics 16(1): 13–Relationship between Segmental Duplications and Repeat Sequences in Human Chromosome 7

      Add to Reading List

      Source URL: www.jsbi.org

      Language: English - Date: 2005-12-28 10:55:26
      60Genome Indices database  1 Integration of Biological Features of Multiple Genomes - The Construction of “Genome Indices” database Shujiro Okuda

      Genome Indices database 1 Integration of Biological Features of Multiple Genomes - The Construction of “Genome Indices” database Shujiro Okuda

      Add to Reading List

      Source URL: www.jsbi.org

      Language: English - Date: 2004-06-07 22:06:09